Journal: Nature Communications

Article Title: Tripartite motif containing 26 prevents steatohepatitis progression by suppressing C/EBPδ signalling activation

doi: 10.1038/s41467-023-42040-9

Figure Lengend Snippet: a Schematic of the experimental procedure showing the genes expression in L02 cells after adenovirus-mediated TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing TRIM26-CEBPD protein interaction network in Homo sapiens and Mus musculus .

Article Snippet: Homo sapiens full-length TRIM26 sequences and designed short hairpin RNA (shRNA) targeting human TRIM26 (sh TRIM26 ) (shRNA sequences RNA-1: GATGGATATGACGACTGGGAA; RNA-2: GATGGATATGACGACTGGGAA), adenovirus expressing shRNA for silencing of Mus musculus Trim26 (Cat. No: shADV-274978, Vector Biolabs, Malvern, PA), human WT TRIM26 sequences with AXXA and AXXXXA motifs of RING domain mutation, Homo sapiens full-length CEBPD sequences, and adenovirus expressing shRNA for silencing of Mus musculus Cebpd (Cat. No: shADV-255245, Vector Biolabs, Malvern, PA) were respectively packaged into adenovirus by Adeno-XTM Adenoviral System 3 Kit (Cat: 632269, Takara Bio Inc.).

Techniques: Expressing, Transformation Assay, Transfection

Journal: Journal of Leukocyte Biology

Article Title: Frontline Science: Myeloid cell-specific deletion of Cebpb decreases sepsis-induced immunosuppression in mice

doi: 10.1189/jlb.4HI1216-537R

Figure Lengend Snippet: Sepsis was induced by CLP using a 23-gauge needle, and mice were given antibiotics (imipenem) with fluid resuscitation, which produced early (defined as d 1–5) and late (d 6 and thereafter) sepsis phases. (A) Kaplan-Meier survival curve. Mortality was monitored for 28 d, and the death (moribundity) was separated into 2 categories: early deaths (those occurring on d 1–5), and late deaths (those occurring on days 6–28). All moribund mice suffered significant weight loss (>30%), hypothermia (<34°C), and loss of righting reflex. The data were collected from 25 mice/group, pooled from 3 experiments. (B) C/EBPβ cKO diminishes peritoneal bacteria growth in late septic mice. Mice that were moribund during early sepsis were subjected to peritoneal lavage immediately after killing. A corresponding number of surviving, healthy-appearing mice (Cebpb cKO group) were sacrificed and analyzed at the same time. Data were analyzed by GraphPad Prism version 5.0 and are expressed as means ± sd of 10 mice/group.

Article Snippet: Production of BALB/cJ Cebpb- floxed mice The BALB/cJ Cebpb -floxed allele was created by gene targeting in BALB/cJ embryonic stem cells (PRX-Balb/cJ 9; Primogenix Biological Laboratories, Laurie, MO, USA) with a gene-targeting vector described by Sterneck et al. [ 24 ].

Techniques: Produced, Bacteria

Journal: Journal of Leukocyte Biology

Article Title: Frontline Science: Myeloid cell-specific deletion of Cebpb decreases sepsis-induced immunosuppression in mice

doi: 10.1189/jlb.4HI1216-537R

Figure Lengend Snippet: Gr1+CD11b+ cells were isolated from the bone marrow. (A) miRNA-enriched RNA was isolated and analyzed by real-time PCR using miR-21– and miR-181b–specific assay primer sets. Values were normalized to U6 RNA as an internal control. Data are expressed as means ± sd (P < 0.05) of 5 mice/group and are presented as fold change relative to sham, control mice (set at 1-fold). *, compared with sham; **, compared with early sepsis. (B) Overexpression of miR-21 and miR-181 in late sepsis Gr1+CD11b+ cells from C/EBPβ cKO mice attenuated their differentiation capacity. Gr1+CD11b+ cells were isolated from the bone marrow of control and C/EBPβ cKO mice during late sepsis. Cells were transfected with negative control, miR-21 precursors, or miR-181b precursors at 50 nM final concentration. After 24 h in culture, a portion of the cells were used for RNA isolation and miRNA measurement by PCR. (C) The remainder of the cells was differentiated for 6 d with M-CSF plus rIL-4, and percentages of macrophage (F4/80+CD11b+) and dendritic (CD11c+MHC II+) cells were determined by flow cytometry. Data are expressed as means ± sd (P < 0.05) of 5 mice/group and are representative of 2 experiments. The miRNA expression results are presented as fold change relative to sham, control mice (set at 1-fold) as in (A). *, compared with cells from control mice transfected with control precursors; **, compared with cells from Cebpb cKO mice transfected with control precursors; #, compared with cells from control mice.

Article Snippet: Production of BALB/cJ Cebpb- floxed mice The BALB/cJ Cebpb -floxed allele was created by gene targeting in BALB/cJ embryonic stem cells (PRX-Balb/cJ 9; Primogenix Biological Laboratories, Laurie, MO, USA) with a gene-targeting vector described by Sterneck et al. [ 24 ].

Techniques: Isolation, Real-time Polymerase Chain Reaction, Control, Over Expression, Transfection, Negative Control, Concentration Assay, Flow Cytometry, Expressing

Journal: Cells

Article Title: Influence of the Postmortem/Storage Time of Human Corneas on the Properties of Cultured Limbal Epithelial Cells

doi: 10.3390/cells11172716

Figure Lengend Snippet: Gene expression profile and Western blot analysis of four out of the 50 most differentially regulated genes ( CEBPD , PFKL , GPR75 , and ITGAM ) in all hLECs populations. Actin was used as the loading control. Graphs show the differences in CEBPD, PFKL, GPR75, and ITGAM expression between SPM/ST hLECs and LPM/ST hLECs. p -value: * < 0.08.

Article Snippet: Western blots were conducted as described [ ] using 5 μg (GPR75), 10 μg (PFKL), 15 μg (CEBPD), or 20 μg (ITGAM) of proteins and the following primary antibodies: mouse monoclonal antibody against CEBPD (1:100; sc365546, Santa Cruz Biotechnology), PFKL (1:100; sc393713, Santa Cruz Biotechnology), GPR75 (1:1000; sc133137, Santa Cruz Biotechnology), ITGAM (1:100; 14-0112-82, Thermo Fisher Scientific Inc.), actin (1:40,000; CLT9001, Cedarlane Laboratories Limited, Burlington, ON, Canada), and a peroxidase-conjugated AffiniPure Goat secondary antibody against mouse IgG (1:2500; 115-036-003, Jackson ImmunoResearch Laboratories, Baltimore, PA, USA).

Techniques: Gene Expression, Western Blot, Control, Expressing

Journal: Nature Communications

Article Title: Tripartite motif containing 26 prevents steatohepatitis progression by suppressing C/EBPδ signalling activation

doi: 10.1038/s41467-023-42040-9

Figure Lengend Snippet: a – d Records for the body weight ( a ), liver weight and the ratio of liver weight/body weight (%) (LW/BW) ( P < 0.0001 by one-way ANOVA) ( b ), fasting blood glucose levels, fasting insulin levels, fasting insulin levels and homoeostasis model assessment of insulin resistance (HOMA-IR) index ( P < 0.0001 by one-way ANOVA) ( c ) and glucose tolerance test (GTT) analysis ( P < 0.0001 by one-way ANOVA) ( d ) of the HFHC-fed HKO ( Trim26 ) mice, hepatocyte-specific Cebpd deletion-HKO ( Cebpd ) mice, hepatocyte-specific Trim26 and Cebpd double knockout-DHKO ( Trim26 - Cebpd ) mice and Flox mice ( n = 15 mice per group). e Liver lipid contents including triglyceride (TG) ( P < 0.0001 by one-way ANOVA), total cholesterol (TC) ( P < 0.0001 by 2 tailed t test) and non-esterified fatty acid (NEFA) ( P < 0.0001 by one-way ANOVA) in the indicated group ( n = 15 mice per group). f , g Pearson correlation analyses showing the correlations between serum tumour necrosis factor (TNF-α) levels and fasting blood glucose ( f ), and fasting insulin and ratio of liver weight/body weight (%) ( g ) in HKO ( Trim26 ) HFHC, HKO ( Cebpd ) HFHC, DHKO ( Trim26 - Cebpd ) HFHC and Flox HFHC group. P < 0.01 for all of these correlations ( n = 15 per parameter; n = 45 in total; P < 0.0001 by one-way ANOVA). h Representative pictures of H&E staining, oil red O staining and NAS score ( P < 0.0001 by one-way ANOVA) in indicated group (scale bars: magnification, 100×; n = 15 images per group for each staining). i Circle correlation analysis showing the correlation between a series of indicators in HKO ( Trim26 ) HFHC, HKO ( Cebpd ) HFHC, DHKO ( Trim26 - Cebpd ) HFHC and Flox HFHC group. j , k Representative pictures of immunohistochemical analysis of F4/80 ( P < 0.0001 by one-way ANOVA) and CD11b ( P < 0.0001 by one-way ANOVA) (scale bars: magnification, ×200; n = 15 images per group for each staining) ( j ) and sirius red ( P < 0.0001 by one-way ANOVA) & masson staining ( P < 0.0001 by one-way ANOVA) (scale bars: magnification, ×100; n = 15 images per group for each staining) ( k )-indicated histological changes in liver, and corresponding hepatic hydroxyproline & collagen contents in HKO ( Trim26 ) HFHC, HKO ( Cebpd ) HFHC, DHKO ( Trim26 - Cebpd ) HFHC and Flox HFHC group. Data are expressed as mean ± SEM. The relevant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance.

Article Snippet: Hepatocyte-specific Cebpd ablation (HKO) mice were created through the breeding of Cebpd flox/flox mice with transgenic mice expressing the albumin-cre tool (Alb-Cre) (Cyagen Biosciences, Suzhou, China).

Techniques: Double Knockout, Staining, Immunohistochemistry